adapters
Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters
Identifier: https://w3id.org/mixs/0000048
| Syntax | Example |
|---|---|
{text};{text} | AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT |
Used in packages
Section titled “Used in packages”| Level | Package | Requirement |
|---|---|---|
| Sample | air | optional |
| Sample | host associated | optional |
| Sample | human associated | optional |
| Sample | human gut | optional |
| Sample | human oral | optional |
| Sample | human skin | optional |
| Sample | human vaginal | optional |
| Sample | microbial mat biolfilm | optional |
| Sample | plant associated | optional |
| Sample | sediment | optional |
| Sample | soil | optional |
| Sample | wastewater sludge | optional |
| Sample | water | optional |
| Sample | miscellaneous natural or artificial environment | optional |
| Sample | ENA Micro B3 | optional |
| Sample | built environment | optional |
| Sample | GSC MIMAGS | optional |
| Sample | GSC MISAGS | optional |
| Sample | GSC MIUVIGS | optional |
| Sample | ENA binned metagenome | optional |
| Sample | HoloFood Checklist | recommended |